Protein Synthesis

My DNA Molecule:

ATCCTACCAAGGGAACGTAAGTGTTAGCCGCTTGTCTATCCGCG

• I feel that out of the men who influenced Charles' Darwin, it was Thomas Malthus who had the greatest influence on him and shaped his theories of evolution.

• Thomas Malthus wrote Essay on the Principle of Population in 1978 which ended up being literature that Charles Darwin greatly admire and used as a stepping block to expand his own ideas from. Malthus' essay spoke of natural selection and that not only wild life and plant life, but also man kind tends to produce far too many offspring which could ultimately lead to the demise of man kind. He explained further that producing too much offspring made it so that there are not enough resources for everyone so only the stronger and more capable will survive. This idea was also expanded on by Darwin and theorized as the survival of the fittest. Malthus even went as far as to suggest that lower income families should not have as many children since they can not afford to support them as wealthier families could. This is something that was later used by China in there limited families to only reproducing 1 child. Malthus ideas were a springboard for many, but ultimately it was Charles Darwin who was influenced and expanded upon these ideas. http://www.ucmp.berkeley.edu/history/malthus.html 

• There are two of Darwin's points of Evolution that were directly related to the thoughts of Thomas Malthus being that resources are limited (overproduction of offspring) and who gets better access to resources (survival of the fittest). In fact these two points are closely related to each other by cause and effect. When any organism whether it be animal, plant, or even man produces too much offspring and overpopulates it leaves only limited resources to be consumed. When this happens it becomes a struggle to get the need resources, and in this battle the stronger will succeed and survive.

• I think that Darwin would have eventually figured these key points of evolution out on his own even if Thomas Malthus had not written about it first. Darwin was an amazing man who was on a path to discovery regardless of his predecessors. However, it is always easier to build a structure when there is already a strong foundation to support it. For this reason I believe that Malthus' idea only strengthened Darwin's expansion of it.

• Darwin's theories of evolution came at a time when opposing the church was not wise. Because of this Darwin kept his thoughts and finding mostly to himself and really only spoke of them to his brother. However, other writers and theorist found his ideas to be extremely helpful and used it to support their own theories. 

Scientific Method Scenario Discussion

A fellow student has a constant routine of falling asleep in class within 15 minutes of the lecture starting.  I am starting to get really irritated because I think that it is disrespectful and disruptive to those of us trying to pay attention and understand the material. 


My hypothesis to this scenario is that the student is not getting enough sleep at night and therefore is too tired during the day and easily falls asleep in a fitting environment. A classroom sometimes fits this description as it can be a quite room and often only one monotone voice is present. 


A way of testing this hypothesis would be to ask the student to get 8 hours of sleep the night before the class. Obviously the student would have to be willing to participate and honest about whether or not they followed through with it. If the student participated and got the 8 hours of sleep as agreed upon and stayed awake through class that day, than the hypothesis would be supported. However, if the student were to still fall asleep, then the hypothesis would be falsified. 


An untestable hypothesis to this scenario would be that the student's mother sang a song to him every day at the same time when he was a baby and young child so that he could fall asleep. The mid point of this particular class happens to fall right at this same time and sub-consciously the student still hears his mother's voice singing him to sleep unless he is doing something active enough that he is not affected by it.