Human Variation and Race

1. Select one of the following environmental stresses:  Heat, high levels of solar radiation, cold, high altitude.  Discuss specifically how this environmental stress negatively impacts the survival of humans. 

Cold is a environmental stress that can impact the survival of humans in numerous ways, ranging from a simple annoyance all the way to fatal impact. In some cases being cold can just be uncomfortable and cause the need to bundle up, or it can go as far as to cause skin problems, for example exposure to extreme cold can lead to the outbreak of cold sores for some people. In some areas snow is a prominent condition that can even block roads and force people to be stuck where they are. In stuck in a severe cold situation people can get hypothermia, lose limbs, or even freeze to death.

2. Identify 4 ways in which humans have adapted to this stress, choosing one adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural).  Include images of the adaptations.

Short term: Sweating, or perspiration, is a reaction of the body to cool itself when exerting energy.

Facultative: Tanning is something the body does to protect the skin from the sun's ultra-violet rays.

Developmental: To adapt to heat stress, bodies tend to be taller, skinnier, and have longer limbs.

Cultural: People who climb mountains will use oxygen tanks in order to aid their breathing at the high altitudes.

3. What are the benefits of studying human variation from this perspective across environmental clines?  Can information from explorations like this be useful to help us in any way?  Offer one example of how this information can be used in a productive way.  

The benefit of studying human variation across environmental clines is to study the differences and similarities amongst different cultures, environments, and situations. These studies are helpful to us because we learn our bodies and how to adapt as well as what to do to prepare ourselves for certain situations. An example of this would be knowing that if you were gonna be climbing a mountain, knowing to take an oxygen tank with you.

4. How would you use race to understand the variation of the adaptations you listed in #2?  Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race. 

When studying adaptation and environmental influences race does not play as much of a role as location does. Though certain races are grouped together in locations, it is not the group that makes them how they are, it is the adaption to their location and situation.

Language

  Language is something we take for granted in our lives every day. We use it constantly in our interactions with others, with our pets, and even people who speak different languages. Whether it be in-person, over the phone, or even communicating via computer, language is what makes it possible to interact and go on performing our daily needs easily. During Thanksgiving we were asked to take part in an evaluation that had two parts to it; The first being to engage in conversation but not speak, write, or use sign-language, and the second being to engage in conversation without and movement or tone variation while speaking.

  The first act of engaging in a conversation for 15 minutes while not speaking or writing seemed nearly impossible.  I found myself basically sitting out in the conversation while others spoke amongst themselves. I would like to think if the others talking absolutely needed an answer from me they would find a way to ask, however I simply became obsolete for the time being and they just when on not including me.  If I were of a different culture meeting my fellow conversation partners for the first time I would feel very left out as well as bothered. I would not know if they were talking about me or if I could even trust what they are trying to tell me.  As far as having the upper hand, strength comes in numbers; whichever group is larger and can communicate together will ultimately have the upper hand.  An example of this in our culture would be people whom deaf and unable to hear others. Though deaf people do have sign language and the ability to communicate with each other and even read lips of people who are talking, anyone who does know sign language will not be able to understand them.

  Next I engaged in conversation where I was able to speak, however I could not move, motion, or vary my tone of voice. Though I was now part of the conversation and no longer ignored, this proved to be extremely difficult and was just plain odd.  I kept up the act for 15 minutes and must have broken the rules at least a dozen times without meaning to. I tend be a very sarcastic person and I now realize that without being able to change your tone, sarcasm simply cannot exist and be picked up on. My partners seemed to grow less and less interested in what I had to say since it was misunderstood and had to be explained each time. They found it easier to just limit the amount of time they spent talking to me.  This truly demonstrates that in order to be understood, signs are needed as well as speaking. The advantage to reading body language is the ability to interpret a scenario as it is unfolding and be one-step ahead or even have the upper-hand. However, reading body language doesn’t work for everyone, especially if someone tends to be an over-thinker.  I once read a book called, How to read a Person Like a Book, and it said that if a girl crosses her legs towards you she is interested away if she is not. I personally found this to be a useful tool as it helped me build confidence at times that seemed to be helpful. However, I told this to a few friends and two in particular were over-thinkers and it ruined them. They panicked at the first sight of legs crossed away and tumbled down hill from there after.

  To sum it all up, language it extremely important it the world we live in, and without the aid of signs to go along with it, it seems to fall somewhat short. Upon completing my 30 minutes of conversation and observation, I found that I had either chose a very rude specimen to observe or that the world tends to push aside those who cannot keep up with communication.

The Piltdown Hoax

The Piltdown Hoax was an attempt to show people that discoveries had been made of a man who’s bone structured differed from ours, thus proving that humans had evolved. This hoax took place in England in 1912 and began when pieces of a skull were found by diggers and given to a man named Charles Dawson. Together Dawson, Sir Arthur Woodward, Pierre Telihard, and others presented the public with what was supposed to be the earliest found human bone structure; However, this structure consisted of animal bones as well as human. Once proud of it’s finding and scientific impact, England was left ashamed and somewhat scarred in the science field after is was discovered that this was only a hoax.

The human faults that come into play in this hoax are deception and the willingness to cheat. We all know what it like to want something unattainable in the worst way, yet only some are willing to cheat and go as far as to lie or trick others in order to get it. In this case these scientist wanted so badly to show their evolution proving man to the public that they deceived everybody and cheated by using animal bones.

In 1953, evidence was given by scientists who had reviewed the Piltdown man that showed that it was a forgery. They provided evidence that proved that the human skull used was dated earlier than Dawson had stated using a chemical test called fluorine absorption.  It was also proved tat the bones had been stained to look the proper age by use of iron solution and chromic acid. And finally after using microscopes, file marks were found on the teeth that proved that the teeth had been altered to resemble that of humans. With these findings they concluded that the Piltdown man had medieval aged skull, jaw from a 500-year-old orangutan, and teeth from a chimpanzee. The positive aspect here is that scientist themselves evolved and found methods to disprove the findings and making the falsifiable.

Removing the “human” factor from science does reduce the chance of error significantly. However, if you were to remove the “human” factor entirely you would be left with nothing after removing the driving force of science itself. It’s the curiosity of human that created science and the urge to better understand the world we live in.  

The life lesson that can be learned here is to trust no one! Even when something seems right, check it and double-check it, before getting a second opinion!

Primates

Lemurs:

Lemurs are found in Madagascar and the Comoros Islands. They tend to live mainly in rain-forest environments but can sometimes be found in desert-like climates. They are primarily vegetarians, feeding on leaves and fruits, but sometimes eat insects and smaller prey. Their diets are adapted to the environment in the fact that they are limited to the food in their particular habitat. In this case they have adapted to eating food found in either tropical forests or in deserts.

Spider monkeys are found living in the tree-tops of tropical rainforests ranging from Mexico down to Brazil. Spider monkeys will eat plants, seeds, nuts, fruits, and even small birds. Their diets are adapted to the environment in the fact that they are limited to what food can be found in their particular habitat. In this case they are adapted to eating what can be found within the trees and at the tree tops.

   

Baboons:

Baboons are found living in Africa and Asia primarily in desert-like environment and occasionally in tropical forests as well. Baboons tend to eat everything they can get their hands on. This includes fruits, plants, seeds, bark, insects, and smaller prey. Their diets are adapted to the environment in the fact that they are limited to what food can be found in their particular habitat. In this case they have adapted to eating food found in either tropical forests or in deserts.

Gibbons:

Gibbons are known to reside in trees in southern Asia and are rarely known to be on the ground. Gibbons eat primarily fruit, but very rarely will eat insects or smaller prey. Their diets are adapted to the environment in the fact that they are limited to what food can be found in their particular habitat. In this case they don’t need to adapt much as their primary food is fruit which is easily found in their environment.

Chimpanzees:

Chimpanzees live primarily in Africa in the forests and grasslands and the species are separated by the Congo River. Chimpanzee’s diets consist of plants, fruits, seeds, insects and meats of smaller prey, and even human food if it provided to them. Their diets are adapted to the environment in the fact that they are limited to what food can be found in their particular habitat. In this case they are limited to what can be found in the forests and grasslands of Africa.

Spider Monkeys:

Homologous and Analogous Traits

For homologous traits I chose to use the example of a human arm and the wing of a bat. Like the human hand, a bats wing has a thumb and finger bones. However the bat has a thin membrane extending from the body and hand and between each finger bone. The human arm/hand of course does not. Much as we use our hands, the bat also uses its fingers, especially thumb to climb. A common ancestor of the bat and human would be the stem reptile, which had a vertebral column and similar bone structures.

For analogous traits I chose to use the example of a human eye and an octopus eye. Both humans and octopuses evolved what is referred to as camera eyes. Its called camera eye because it consists of a lens projecting an image onto a retina. The common ancestor of the octopus and of man possessed this analogous trait and adapted it so it could see.

Protein Synthesis

My DNA Molecule:

ATCCTACCAAGGGAACGTAAGTGTTAGCCGCTTGTCTATCCGCG

• I feel that out of the men who influenced Charles' Darwin, it was Thomas Malthus who had the greatest influence on him and shaped his theories of evolution.

• Thomas Malthus wrote Essay on the Principle of Population in 1978 which ended up being literature that Charles Darwin greatly admire and used as a stepping block to expand his own ideas from. Malthus' essay spoke of natural selection and that not only wild life and plant life, but also man kind tends to produce far too many offspring which could ultimately lead to the demise of man kind. He explained further that producing too much offspring made it so that there are not enough resources for everyone so only the stronger and more capable will survive. This idea was also expanded on by Darwin and theorized as the survival of the fittest. Malthus even went as far as to suggest that lower income families should not have as many children since they can not afford to support them as wealthier families could. This is something that was later used by China in there limited families to only reproducing 1 child. Malthus ideas were a springboard for many, but ultimately it was Charles Darwin who was influenced and expanded upon these ideas. http://www.ucmp.berkeley.edu/history/malthus.html 

• There are two of Darwin's points of Evolution that were directly related to the thoughts of Thomas Malthus being that resources are limited (overproduction of offspring) and who gets better access to resources (survival of the fittest). In fact these two points are closely related to each other by cause and effect. When any organism whether it be animal, plant, or even man produces too much offspring and overpopulates it leaves only limited resources to be consumed. When this happens it becomes a struggle to get the need resources, and in this battle the stronger will succeed and survive.

• I think that Darwin would have eventually figured these key points of evolution out on his own even if Thomas Malthus had not written about it first. Darwin was an amazing man who was on a path to discovery regardless of his predecessors. However, it is always easier to build a structure when there is already a strong foundation to support it. For this reason I believe that Malthus' idea only strengthened Darwin's expansion of it.

• Darwin's theories of evolution came at a time when opposing the church was not wise. Because of this Darwin kept his thoughts and finding mostly to himself and really only spoke of them to his brother. However, other writers and theorist found his ideas to be extremely helpful and used it to support their own theories.